Information
Eduardo Kac >
»Move 36«, 2004
Co-Workers & Funding:
Move 36 was partially funded by the Creative Capital Foundation, New York.http://www.ekac.org/move36.html
Technology
Software
Through genetic modification, the leaves of the plants curl. In the wild these leaves would be flat. The "Cartesian gene" was coupled with a gene that causes this sculptural mutation in the plant, so that the public can see with the naked eye that the "Cartesian gene" is expressed precisely where the curls develop and twist.The "Cartesian gene" was produced according to a new code I created especially for the work. In 8-bit ASCII, the letter C, for example, is: 01000011. Thus, the gene is created by the following associations between genetic bases and binary digits:
A = 00
C = 01
G = 10
T = 11
The result is the following gene with fifty-two bases:
CAATCATTCACTCAGCCCCACATTCACCCCAGCACTCATTCCATCCCCCATC
The creation of this gene is a critical and ironic gesture, since Descartes considered the human mind a "ghost in the machine" (for him the body was a "machine"). His rationalist philosophy gave new impetus both to the mind-body split (Cartesian dualism) and to the mathematical foundations of current computer technology.
Descriptions & Essays
"Move 36" explores the permeable boundaries between the human and the nonhuman, the living and the nonliving. The title of "Move 36" refers to the dramatic chess move made by computer Deep Blue against world champion Gary Kasparov in 1997 -- a chess match between the best player that ever lived and the best player that never lived. The installation includes a plant, especially created for the work, that uses the universal computer code (called ASCII) to produce a "Cartesian" gene, that is, a translation of Descartes' ontological statement "Cogito ergo sum" into a gene. As viewers walk into the space, they see a chessboard made of sand and earth, flanked by digital projections that evoke the players in absentia. The plant is rooted precisely in the square where the computer defeated the human, that is, where the "move 36" was made.
EDUARDO KAC
Literature
Dixon, Steve. Digital Performance: A History of New Media in Theatre, Dance, Performance
Art and Installation. Leonardo Books, Cambridge, MA: MIT Press, 2007.
Dixon, Steve. »Metal Performance: Humanizing Robots, Returning to Nature, and Camping
About.« TDR 48, no. 4 (Winter 2004).
Kac, Eduardo. »GFP Bunny.« Kunstforum 158 (January-March 2002): 46-57.
Kac, Eduardo. »Gravitropism: Art and the Joys of Levitation.« In I Leviate, What´s Next, edited by Aleksandra Kostic, 88-97. Maribor, SL: Kibla, 2001.
Bosco, Roberta and Stefano Caldana. »Un Mundo Verde Fluorescente.« Ciberp@is Mensual , no. 15 (Octobre 2001).
Kac, Eduardo. »Arte Transgenikoa.« Zehar 45 (2001): 22-25.
Landa, Kepa, ed. Futuros Emergentes: Arte, Interactividad y Nuevos Medios. Valencia, ES: Institució Alfonse el Magnánim, Diputació de Valencia, 2000.
Kac, Eduardo. »Negotiating Meaning: The Dialogic Imagination in Electronic Art.« In Proceedings of Computers in Art and Design Education Conference, edited by UK University of Teesside. Teeside, UK: 1999.
Kac, Eduardo. »Genesis.« In Ars Electronica 1999: LifeScience, edited by Gerfried Stocker and Christine Schöpf. Wien, New York: Springer Verlag, 1999.
Kac, Eduardo. »Beyond the Screen: New Directions in Interactive Art.« Blimp: Film Magazine 40 (1999): 49-54.
Kac, Eduardo. »Eduardo Kac: Teleporting an Unkown State.« In Teleporting an Unknown State, edited by Peter Tomaz Dobrila and Aleksandra Kostic, 4-7. Maribor, Slovenia: KIBLA Maribor, 1998.
Kac, Eduardo. »Novos Rumos na Arte Interativa.« Veredas 3, no. 32 (August 1998): 12-15.
Kac, Eduardo. »Transgenic Art.« Leonardo Electronic Almanac 6, no. 11 (December 1998).
Kac, Eduardo. »Das Internet und die Zukunft der Kunst: Immaterialität, Telematik, Videokonferenzen, Hypermedia, Networking, VRML, Interaktivität, Bildtelefone, Künstlersoftware, Telerobotik, Mbone und darüber hinaus.« In Mythos Internet, edited by Stefan Münker and Alexander Rösler, 291-318. Frankfurt/Main: Suhrkamp, 1997.
Kac, Eduardo. »A-positive.« In ISEA ´97 Program Guide, edited by The School of the Art Institute of Chicago, 62. Chicago: ISEA, 1997.
Kac, Eduardo. »Holopoetry und darüber hinaus.« Passauer Pegasus 15, no. 29/30 (1997): 106-119.
Kac, Eduardo and Marcel.li Antunez Roca. »Robotic Art.« Leonardo Electronic Almanac 5, no. 5 (May 1997).
Kac, Eduardo. »Origin and Development of Robotic Art.« Art Journal 56, no. 3 (1997): 60-67.
Kac, Eduardo, ed. New Media Poetry: Poetic Innovation and New Technologies. Vol.30. Visible Language, Rhode Island: Rhode Island School of Design, 1996.
Kac, Eduardo. »Interactive Art on the Internet.« In Ars Electronica 1995. Welcome to the Wired World, edited by Peter Weibel and Karl Gerber, 170-179. Wien, New York: Springer Verlag, 1995.
Kac, Eduardo. »Eduardo Kac: Dialogues.« Dialogue: Arts in the Midwest 18, no. 1 (Jan/Feb 1995): 14-16.
Kac, Eduardo. »Essay Concerning Human Understanding.« Leonardo Electronic Almanac 3, no. 8 (August 1995).
Osthoff, Simone and Eduardo Kac. »Eduardo Kac -- The Aesthetics of Dialogue.« .
Kac, Eduardo. »Aspects of the Aesthetics of Telecommunications.« In Zero -- The Art of Being Everywhere, edited by Gerfried Stocker. Graz, Austria: Steirische Kulturinitiative Graz, 1993.
Kac, Eduardo. »Aspekte einer Ästhetik der Telekommunikation.« In Zero - The Art of Being Everywhere, edited by Gerfried Stocker. Graz, Austria: Steirische Kulturinitiative Graz, 1993.
Kac, Eduardo. »Holopoetry, Hypertext, Hyperpoetry.« In Proceedings of the Holographic Imaging Conference, edited by SPIE 2043, . Bellingham, WA: Holographic Imaging and Materials (Proc. SPIE 2043), Tung H. Jeong, Editor (Bellingham, WA: SPIE,, 1993.
Kac, Eduardo. »Aspects of the Aesthetics of Telecommunications.« In Siggraph Visual Proceedings, edited by John Grimes, 47-57. New York: 1992.
Kac, Eduardo. »On the Notion of Art as a Visual Dialogue.« In Art-Reseaux, edited by Karen O´Rourke, 20-23. Paris: Université de Paris I, Panthéon-Sorbonne, 1992.
Kac, Eduardo. »Ornitorrinco: Exploring Telepresence and Remote Sensing.« Leonardo 24, no. 2 (1991): 233.
Exhibitions & Events